ID: 934102509

View in Genome Browser
Species Human (GRCh38)
Location 2:88666566-88666588
Sequence TAACCTTACCCCAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934102507_934102509 -3 Left 934102507 2:88666546-88666568 CCTAAGTATCACAGGTAAGATAA No data
Right 934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG No data
934102505_934102509 19 Left 934102505 2:88666524-88666546 CCAGAAGTCTTATCTTTATAGAC No data
Right 934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG No data
934102504_934102509 24 Left 934102504 2:88666519-88666541 CCTGGCCAGAAGTCTTATCTTTA No data
Right 934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934102509 Original CRISPR TAACCTTACCCCAGTGAGGA TGG Intergenic
No off target data available for this crispr