ID: 934104168

View in Genome Browser
Species Human (GRCh38)
Location 2:88680852-88680874
Sequence TTACCCTGATGGGTAGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104160_934104168 22 Left 934104160 2:88680807-88680829 CCTCTCAGCTACAGTGGCTCTAC No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data
934104164_934104168 -5 Left 934104164 2:88680834-88680856 CCCAGCTGATCTCTCAGCTTACC No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data
934104163_934104168 -4 Left 934104163 2:88680833-88680855 CCCCAGCTGATCTCTCAGCTTAC No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data
934104162_934104168 -3 Left 934104162 2:88680832-88680854 CCCCCAGCTGATCTCTCAGCTTA No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data
934104161_934104168 -2 Left 934104161 2:88680831-88680853 CCCCCCAGCTGATCTCTCAGCTT No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data
934104165_934104168 -6 Left 934104165 2:88680835-88680857 CCAGCTGATCTCTCAGCTTACCC No data
Right 934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104168 Original CRISPR TTACCCTGATGGGTAGCTCA CGG Intergenic