ID: 934104238

View in Genome Browser
Species Human (GRCh38)
Location 2:88681377-88681399
Sequence ACTTGGCCCTGGGGTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104238_934104245 17 Left 934104238 2:88681377-88681399 CCTGTTACACCCCAGGGCCAAGT No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104238_934104246 29 Left 934104238 2:88681377-88681399 CCTGTTACACCCCAGGGCCAAGT No data
Right 934104246 2:88681429-88681451 GCCTACATAGGACCTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104238 Original CRISPR ACTTGGCCCTGGGGTGTAAC AGG (reversed) Intergenic
No off target data available for this crispr