ID: 934104242

View in Genome Browser
Species Human (GRCh38)
Location 2:88681388-88681410
Sequence GCCACTGGAAAACTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104242_934104248 28 Left 934104242 2:88681388-88681410 CCAGGGCCAAGTTTTCCAGTGGC No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data
934104242_934104245 6 Left 934104242 2:88681388-88681410 CCAGGGCCAAGTTTTCCAGTGGC No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104242_934104246 18 Left 934104242 2:88681388-88681410 CCAGGGCCAAGTTTTCCAGTGGC No data
Right 934104246 2:88681429-88681451 GCCTACATAGGACCTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104242 Original CRISPR GCCACTGGAAAACTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr