ID: 934104245

View in Genome Browser
Species Human (GRCh38)
Location 2:88681417-88681439
Sequence AGCAATTTGTCTGCCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104243_934104245 0 Left 934104243 2:88681394-88681416 CCAAGTTTTCCAGTGGCTTTTGA No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104238_934104245 17 Left 934104238 2:88681377-88681399 CCTGTTACACCCCAGGGCCAAGT No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104239_934104245 8 Left 934104239 2:88681386-88681408 CCCCAGGGCCAAGTTTTCCAGTG No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104244_934104245 -9 Left 934104244 2:88681403-88681425 CCAGTGGCTTTTGAAGCAATTTG No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104240_934104245 7 Left 934104240 2:88681387-88681409 CCCAGGGCCAAGTTTTCCAGTGG No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data
934104242_934104245 6 Left 934104242 2:88681388-88681410 CCAGGGCCAAGTTTTCCAGTGGC No data
Right 934104245 2:88681417-88681439 AGCAATTTGTCTGCCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104245 Original CRISPR AGCAATTTGTCTGCCTACAT AGG Intergenic
No off target data available for this crispr