ID: 934104248

View in Genome Browser
Species Human (GRCh38)
Location 2:88681439-88681461
Sequence GACCTCACTCTGGCCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104244_934104248 13 Left 934104244 2:88681403-88681425 CCAGTGGCTTTTGAAGCAATTTG No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data
934104243_934104248 22 Left 934104243 2:88681394-88681416 CCAAGTTTTCCAGTGGCTTTTGA No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data
934104242_934104248 28 Left 934104242 2:88681388-88681410 CCAGGGCCAAGTTTTCCAGTGGC No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data
934104239_934104248 30 Left 934104239 2:88681386-88681408 CCCCAGGGCCAAGTTTTCCAGTG No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data
934104240_934104248 29 Left 934104240 2:88681387-88681409 CCCAGGGCCAAGTTTTCCAGTGG No data
Right 934104248 2:88681439-88681461 GACCTCACTCTGGCCCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104248 Original CRISPR GACCTCACTCTGGCCCTTTA AGG Intergenic
No off target data available for this crispr