ID: 934104792

View in Genome Browser
Species Human (GRCh38)
Location 2:88685781-88685803
Sequence TCTCCATCATGTATCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934104792_934104793 3 Left 934104792 2:88685781-88685803 CCATCAGGGATACATGATGGAGA No data
Right 934104793 2:88685807-88685829 AATTCTGCCCCTGCCTCCCTTGG No data
934104792_934104794 9 Left 934104792 2:88685781-88685803 CCATCAGGGATACATGATGGAGA No data
Right 934104794 2:88685813-88685835 GCCCCTGCCTCCCTTGGACCTGG No data
934104792_934104798 13 Left 934104792 2:88685781-88685803 CCATCAGGGATACATGATGGAGA No data
Right 934104798 2:88685817-88685839 CTGCCTCCCTTGGACCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934104792 Original CRISPR TCTCCATCATGTATCCCTGA TGG (reversed) Intergenic