ID: 934105859

View in Genome Browser
Species Human (GRCh38)
Location 2:88693864-88693886
Sequence CCACAGAAACAGACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 495}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934105859_934105863 -8 Left 934105859 2:88693864-88693886 CCCAGCTCTGTCTGTTTCTGTGG 0: 1
1: 0
2: 2
3: 55
4: 495
Right 934105863 2:88693879-88693901 TTCTGTGGGTGTAGCCACCCAGG 0: 1
1: 0
2: 2
3: 20
4: 203
934105859_934105869 15 Left 934105859 2:88693864-88693886 CCCAGCTCTGTCTGTTTCTGTGG 0: 1
1: 0
2: 2
3: 55
4: 495
Right 934105869 2:88693902-88693924 ATGGGTCGACATGCAGAACTAGG 0: 1
1: 0
2: 0
3: 3
4: 52
934105859_934105865 -3 Left 934105859 2:88693864-88693886 CCCAGCTCTGTCTGTTTCTGTGG 0: 1
1: 0
2: 2
3: 55
4: 495
Right 934105865 2:88693884-88693906 TGGGTGTAGCCACCCAGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 108
934105859_934105864 -4 Left 934105859 2:88693864-88693886 CCCAGCTCTGTCTGTTTCTGTGG 0: 1
1: 0
2: 2
3: 55
4: 495
Right 934105864 2:88693883-88693905 GTGGGTGTAGCCACCCAGGATGG 0: 1
1: 1
2: 1
3: 47
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934105859 Original CRISPR CCACAGAAACAGACAGAGCT GGG (reversed) Intronic
900215951 1:1481815-1481837 CCACAGACACACACAGACCTTGG - Intronic
900223089 1:1519869-1519891 CCACAGACACACACAGACCTTGG - Intronic
900887733 1:5427376-5427398 CCAGAGAGACAGTCTGAGCTGGG - Intergenic
900933264 1:5749674-5749696 ACACAGAAACAGAAAGAGATGGG + Intergenic
901028311 1:6291010-6291032 CCACAGAGACAGAGGCAGCTTGG + Intronic
901709376 1:11101578-11101600 ACACAGAACCAGCCAGAGCTTGG - Intergenic
903275238 1:22217441-22217463 CTTCAGAATCAGACAGACCTGGG - Intergenic
903982336 1:27198286-27198308 ACTTAGAAACAGACAGACCTGGG - Intergenic
903988350 1:27246256-27246278 CTACAGAGACAGAAAGAGATGGG - Intronic
904262861 1:29300174-29300196 CCACGGTCACATACAGAGCTGGG + Intronic
904450272 1:30606428-30606450 CCACAGAGATGGGCAGAGCTGGG + Intergenic
904611038 1:31726460-31726482 CCACAGTCAGAGGCAGAGCTGGG - Intergenic
904664855 1:32112224-32112246 CCACAAACAAAGACAGAGATGGG + Intronic
905122129 1:35690444-35690466 CAACAAAAAAAGACAGAACTGGG - Intergenic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
905894966 1:41539633-41539655 CCACACAAATGGCCAGAGCTGGG + Intronic
906003819 1:42451305-42451327 CAGCAAAAACAGACAGAACTGGG - Intronic
906127162 1:43433953-43433975 CCACAGTAAGTGACAGAGCCAGG + Intronic
906400254 1:45499299-45499321 GCACAGAAAGAGAAAGGGCTTGG + Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
907591637 1:55678575-55678597 CCACAAAAACATAAAGATCTTGG - Intergenic
909562870 1:77024991-77025013 CCACAGACAGAGAGAGAGCCTGG - Intronic
910092591 1:83482844-83482866 GAACAGAAAAAGAAAGAGCTGGG + Intergenic
910105965 1:83631436-83631458 ACACACACACACACAGAGCTAGG + Intergenic
910587347 1:88894048-88894070 ACACACACACACACAGAGCTGGG + Intergenic
911300603 1:96168458-96168480 CCACAGAAATAGTGAGAGATGGG - Intergenic
911470603 1:98313316-98313338 CCAGAGAAAGTGACAGAGTTGGG + Intergenic
911560411 1:99399183-99399205 CCTCCTCAACAGACAGAGCTAGG - Intergenic
912041104 1:105391831-105391853 CCTGAGAAAGAGAAAGAGCTGGG + Intergenic
912508686 1:110173968-110173990 CCCCACAAAGAGACAGACCTGGG - Exonic
912784711 1:112589874-112589896 CCCCACACACAGCCAGAGCTGGG - Intronic
913969368 1:143402862-143402884 ACACAGAAGCAAACAGAGCCTGG + Intergenic
914063745 1:144228461-144228483 ACACAGAAGCAAACAGAGCCTGG + Intergenic
914115405 1:144737893-144737915 ACACAGAAGCAAACAGAGCCTGG - Intergenic
914425891 1:147575512-147575534 CTACAGAATCACACAGAGTTGGG - Intronic
914728777 1:150352072-150352094 CAACAGAAAAAGACAGTACTGGG - Intronic
914996275 1:152545918-152545940 CCAGAGTAACAGACAAGGCTTGG + Intronic
915044888 1:153003965-153003987 CCATAGAAACAAACAGTACTGGG - Intergenic
915088503 1:153405233-153405255 CCGCATACACAGACAGTGCTAGG - Intergenic
915096391 1:153465599-153465621 CCGCATACACAGACAGTGCTGGG + Intergenic
915130142 1:153690153-153690175 ACACACACACACACAGAGCTGGG + Intronic
916005384 1:160654748-160654770 CCTGAGAAACAGAGACAGCTGGG + Intergenic
916964732 1:169925782-169925804 CCTCACAAACAGCCAGAGGTAGG - Intronic
916997912 1:170321370-170321392 CCACCGAAAATGACAGAACTTGG - Intergenic
917089257 1:171336495-171336517 CAACAAAAGCAGACAGAGCCTGG + Intronic
917364226 1:174211174-174211196 TCACAGAAAAAGACAGAGTATGG + Intronic
917590537 1:176471522-176471544 CCAGATAAACAAACAGAACTTGG + Intronic
919690284 1:200522972-200522994 GCACAGAAAGATACAGAGCTGGG + Intergenic
919745516 1:201006126-201006148 CCTCAGAGACAGTCAGGGCTAGG - Intronic
920431003 1:205919092-205919114 CCTCAGATACAGCAAGAGCTGGG - Intronic
920947563 1:210544036-210544058 ACCCCGAAACAGACAGATCTTGG - Intronic
921196230 1:212760356-212760378 CCACAGCAACAGACAGAATGAGG - Intronic
921573480 1:216806188-216806210 CCTCTGAAATAGACAGAACTTGG - Intronic
922465408 1:225843018-225843040 ACACAGGACCAGACAGTGCTGGG + Intronic
923262458 1:232280369-232280391 CCAGAGAAAGAGAAATAGCTGGG + Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
924746621 1:246840974-246840996 ACACAGAAAAAGAAAGTGCTTGG - Exonic
1062958911 10:1558335-1558357 CCACAGAATGGGACAGAGGTGGG - Intronic
1062958960 10:1558512-1558534 CCACAGAAGGGGACAGAGGTGGG - Intronic
1062958975 10:1558571-1558593 CCACAGAAGGGGACAGAGGTGGG - Intronic
1063198530 10:3765510-3765532 ACTCAGAAACAGAAAGATCTGGG - Intergenic
1066752400 10:38671481-38671503 CAATATAAACATACAGAGCTGGG - Intergenic
1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG + Intergenic
1067278527 10:44854450-44854472 TCACAGCAACCCACAGAGCTGGG + Intergenic
1067287074 10:44914514-44914536 CCATGGAAGCAGACACAGCTGGG + Intronic
1067565672 10:47334897-47334919 CCAGTGAAACAGACAGAGATGGG - Intergenic
1067973768 10:51000915-51000937 ACACAGATACAGAGAGAACTCGG - Intronic
1068802922 10:61162425-61162447 CCACAGAAATGGAGAGGGCTGGG + Intergenic
1068922483 10:62499419-62499441 CCACAGAAAGACTCAAAGCTGGG - Intronic
1071388865 10:85149728-85149750 TCCCAGAAACAGACAGTGATTGG - Intergenic
1071959079 10:90791472-90791494 CCACAGAAAGATTCAGAGGTAGG + Intronic
1072367295 10:94725781-94725803 ACACAGAGACATACACAGCTGGG + Intronic
1072660093 10:97358628-97358650 CCAGAGAAACAGAGTCAGCTAGG + Intronic
1072677337 10:97477887-97477909 GCACAGAAACAGCCAGCCCTGGG + Exonic
1072725356 10:97809488-97809510 CCACAGCAAGTGACAGAGCTGGG + Intergenic
1073613579 10:104969866-104969888 GCACAGAAAGAAACAGAGCTAGG + Intronic
1074032946 10:109707042-109707064 CAACAGGTACAGACAGACCTCGG + Intergenic
1074273904 10:111982791-111982813 ACACATAGACAGACAGAGATGGG - Intergenic
1074449115 10:113544899-113544921 AAGCAGAAACAGACAGAGCCAGG - Intergenic
1074543552 10:114385501-114385523 CCAGAGAGTCAGATAGAGCTGGG + Intronic
1074913893 10:117937701-117937723 ACACAGAAAGAGAGGGAGCTGGG + Intergenic
1075164838 10:120058397-120058419 TCAAAGAAGCAGACAGAACTGGG - Intergenic
1075845140 10:125539289-125539311 CCACATATACAGACAGAGGTGGG + Intergenic
1076430827 10:130400921-130400943 CCACATAATGAGACAGAGCAGGG - Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1077478430 11:2801954-2801976 GCACAGAAAAAGCCAGAGCAGGG + Intronic
1077873777 11:6285199-6285221 ACACAGAAACAGAGAGAGAGAGG - Intergenic
1078336137 11:10464770-10464792 CCACAGACAAAGAGGGAGCTGGG - Intronic
1078469539 11:11576035-11576057 ACATAGAAAGAGACAGAGCCAGG + Intronic
1079032094 11:16993453-16993475 CCACAGGAACTGAGAGAGCTGGG - Intronic
1079931951 11:26574303-26574325 ATACAGAAGCAGACATAGCTTGG + Intronic
1080060371 11:27950299-27950321 CTACAAAAACTGAGAGAGCTGGG + Intergenic
1080624219 11:34013995-34014017 ACACAGCAAGAGACAGGGCTAGG + Intergenic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1081040329 11:38201868-38201890 CACCAGAAACAGACAAAGCAAGG + Intergenic
1081430992 11:42976545-42976567 ACACACACACAGACAGTGCTAGG - Intergenic
1081576112 11:44319421-44319443 CCACAGAAAGAGACAGAAGGAGG + Intergenic
1082017261 11:47499664-47499686 CCACAGAAAGAGGCAGGACTGGG + Intronic
1082897167 11:58204338-58204360 CCACAGAAAAAGACAGGACATGG + Intergenic
1083273798 11:61585841-61585863 ACAGAGAAACAGGCAGAGGTAGG - Intergenic
1084521879 11:69668312-69668334 ATGCAGAAACAGACAGAACTGGG + Intronic
1085127821 11:74013797-74013819 GCACAGAAAGAGTCAGGGCTGGG - Intronic
1085254302 11:75163836-75163858 TCACAGAAAGAGACAGAGGGCGG - Intronic
1085348693 11:75784483-75784505 CTATAGAATCAGACAGACCTGGG - Intronic
1085826857 11:79857290-79857312 CCACAGTAAGGGGCAGAGCTGGG + Intergenic
1086276208 11:85132879-85132901 ACACAGAAAGAAGCAGAGCTTGG + Intronic
1086611029 11:88755969-88755991 CTACAAAAACAAACAGAGGTTGG + Intronic
1088735963 11:112727873-112727895 CCTTAGAGTCAGACAGAGCTGGG + Intergenic
1088917712 11:114239894-114239916 ACACAGAAAGAGGCAGAGTTGGG - Intronic
1089002551 11:115064097-115064119 CCACTGCAATAGTCAGAGCTGGG - Intergenic
1089109788 11:116046332-116046354 ACACAGAAACAGAAACAGCCAGG + Intergenic
1089960988 11:122617139-122617161 CTCCAGAATCAGACAGAACTGGG + Intergenic
1090880037 11:130825235-130825257 TTACAGAAAGAGAGAGAGCTGGG - Intergenic
1090948160 11:131449642-131449664 CCACAAGAACAGAGAGAGCACGG - Intronic
1091247258 11:134108559-134108581 ACACACAAACAGCCAGAACTTGG - Intronic
1093271917 12:17073529-17073551 CAACAAAAACAGACAGAGTTGGG + Intergenic
1093570369 12:20660409-20660431 ACACAGTAACAGGCAGAGATTGG + Intronic
1094200996 12:27794357-27794379 CCACAGATACATACAGAGGCAGG - Intronic
1095484160 12:42666956-42666978 CCACAGAATCAAGCAAAGCTTGG + Intergenic
1096252288 12:50040926-50040948 CCAGAGAAACAGACCAGGCTGGG - Intergenic
1096493622 12:52026604-52026626 CCACATAGATAGACAGGGCTGGG + Intronic
1097078693 12:56413542-56413564 CCACAGAACCAGGGAGAGCCAGG - Intergenic
1097724650 12:63061266-63061288 ACACAAGAAGAGACAGAGCTAGG - Intergenic
1097837149 12:64284467-64284489 CCAGAGAGACAGAGAGAACTCGG + Intronic
1098289425 12:68943169-68943191 ACACAGTAAGCGACAGAGCTGGG - Intronic
1098555457 12:71813722-71813744 CCTCTTAAACAGACAGAGGTAGG - Intergenic
1099098842 12:78411130-78411152 CCACAGAAACATGTAGAGCTTGG + Intergenic
1099250937 12:80253075-80253097 ACACAGAATCATAAAGAGCTAGG - Intronic
1100637773 12:96451736-96451758 CCACACACACACACAGAGTTAGG + Intergenic
1101728672 12:107408772-107408794 CCAGAGTAACTGACAGAGCTAGG - Intronic
1101923047 12:108948306-108948328 GCATAGAAGCAGACAGAACTGGG - Intronic
1102210581 12:111123921-111123943 ACACAGCAAAAGTCAGAGCTGGG + Intronic
1102363897 12:112314487-112314509 TTACAGAAACAGACGGATCTAGG - Exonic
1102491500 12:113292004-113292026 CCAGACAGACAGACAGAGCTGGG - Intronic
1102877804 12:116461320-116461342 CCTCAGAGTCTGACAGAGCTGGG - Intergenic
1103198116 12:119063857-119063879 AGACAGAAACAGAGAGAGATGGG + Intronic
1103380715 12:120492040-120492062 TGACAGAAAGTGACAGAGCTGGG - Intronic
1103602150 12:122061242-122061264 CCACAGAAACAGAGAGGCGTAGG + Exonic
1103707229 12:122883344-122883366 CCACAGAAACACAAAAAGCTAGG + Intronic
1105326655 13:19376508-19376530 CCAGACAAACAGGAAGAGCTAGG + Intergenic
1105661728 13:22503374-22503396 CCGAGGAAACAGACAGAGCCAGG + Intergenic
1106408816 13:29496940-29496962 CCACAGAGGCAGACAGTCCTCGG - Intronic
1107670730 13:42743868-42743890 CAACAGTCACAGACAGAGATTGG - Intergenic
1109262921 13:60164428-60164450 ACCCAAAATCAGACAGAGCTAGG + Intergenic
1110357484 13:74584613-74584635 TTACAGATGCAGACAGAGCTAGG + Intergenic
1110446446 13:75587946-75587968 TGAGAGCAACAGACAGAGCTAGG - Intronic
1110851340 13:80248716-80248738 ACACACACACACACAGAGCTGGG + Intergenic
1110930516 13:81210326-81210348 CCACAGAAAATAACAGAACTTGG - Intergenic
1111815922 13:93152469-93152491 GCACAGAGAGAGACAGAGCAAGG - Intergenic
1112151526 13:96769727-96769749 ACACACACACACACAGAGCTAGG - Intronic
1112187422 13:97140919-97140941 CCAAAGAAAGAGAGAGAGATGGG - Intergenic
1112430202 13:99344252-99344274 CCTCAGAGTCAGACACAGCTGGG - Intronic
1112601453 13:100859489-100859511 ACACAGAAACACACAGAGGGAGG - Intergenic
1112611432 13:100958709-100958731 TCACAGTAAGAGAAAGAGCTGGG + Intergenic
1112721413 13:102250146-102250168 TGACAGAAAGAAACAGAGCTAGG + Intronic
1113339983 13:109412841-109412863 CCACGCAGACAGGCAGAGCTGGG + Intergenic
1113858120 13:113460602-113460624 CCACAGACACACACAGAGGCTGG + Intronic
1114058311 14:18995507-18995529 CCACAGTAACAGAAACAGCGTGG - Intronic
1114104235 14:19406247-19406269 CCACAGTAACAGAAACAGCGTGG + Intronic
1115266612 14:31507171-31507193 CCTCTGCAACACACAGAGCTGGG + Intronic
1115758230 14:36551124-36551146 TTACAAAAACAGACAGAGGTTGG - Intergenic
1116078572 14:40144247-40144269 ACACAGATATTGACAGAGCTGGG - Intergenic
1117064674 14:52000107-52000129 ACACAGAAAATGACAGAGCCAGG + Intronic
1118257905 14:64221182-64221204 CCTGAGACACAGCCAGAGCTAGG - Intronic
1118850358 14:69578309-69578331 CTTCAGAATCAGACAGAGCCAGG - Intergenic
1119025007 14:71145644-71145666 CCAAAGTCACAGAGAGAGCTTGG - Intergenic
1119211630 14:72836365-72836387 CCAGAGAAACTGTCAGAGCAGGG + Intronic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1119705369 14:76779756-76779778 CTAGAGCAACAGGCAGAGCTGGG - Exonic
1119878237 14:78078396-78078418 ACAGAGAAACAGACAGCTCTAGG - Intergenic
1119895177 14:78214004-78214026 CCACAGGAACAGACACATCAGGG - Intergenic
1120405625 14:84090844-84090866 CCACAGAGCCAGGAAGAGCTGGG + Intergenic
1120891337 14:89494239-89494261 CCATGGAAACAAACACAGCTAGG + Intronic
1121211961 14:92213968-92213990 CCACAGAGACCGGCAGAGCATGG - Intergenic
1121437898 14:93930902-93930924 CCACAGAAACAGGCATGGCCTGG + Intergenic
1121688399 14:95856719-95856741 CCACAGAAGCAGAGAGAGATTGG - Intergenic
1121820213 14:96959713-96959735 CCACAGCCTCAGAAAGAGCTTGG + Intergenic
1122195685 14:100083337-100083359 ACACAGAACCAGACAGACGTTGG - Intronic
1122256155 14:100478345-100478367 CCACTGGAAGTGACAGAGCTGGG + Intronic
1122859682 14:104577002-104577024 CCACTGCAGCAGAGAGAGCTGGG + Intronic
1122931539 14:104935028-104935050 CCACTGCAACTGCCAGAGCTTGG - Exonic
1124065907 15:26343505-26343527 CCAGAAAAACAGTCAGAGCAGGG - Intergenic
1124612824 15:31220240-31220262 CCACAGACACAGGCTGAGCGGGG - Intergenic
1127639280 15:60900473-60900495 CCTCAGAGTCAGATAGAGCTGGG + Intronic
1127752468 15:62059983-62060005 CCACAGAAACGGGCAGGGCGGGG + Intronic
1129767214 15:78177887-78177909 CCACAGAGACAGAAATAGTTGGG - Intronic
1130401375 15:83557767-83557789 CCACAGAAACAAGCCTAGCTAGG - Intronic
1131346868 15:91657637-91657659 CAACAGTAACACACAGAGCCAGG - Intergenic
1132014123 15:98300825-98300847 ACACAGACACAGACACAGCTGGG - Intergenic
1133147414 16:3799792-3799814 CCACAAATTCAGACAGGGCTTGG - Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1134197692 16:12171516-12171538 ACACAGCTACAGCCAGAGCTGGG - Intronic
1134338579 16:13324331-13324353 CTACAGAAACTCCCAGAGCTAGG - Intergenic
1135058997 16:19255105-19255127 CCACTGAGCTAGACAGAGCTTGG - Intronic
1135479633 16:22812504-22812526 ACACAGTAACTGGCAGAGCTGGG - Intergenic
1136083784 16:27870114-27870136 ACACAGAGACAGACAGAGAGAGG - Intronic
1136514500 16:30759810-30759832 CTTCAGAAGCAGACAGATCTGGG + Exonic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG + Intergenic
1137686516 16:50390599-50390621 CCAGACAGACAGACAGAGCCAGG - Intergenic
1138240781 16:55425392-55425414 CCACAGGATCAGGCAGAGGTTGG + Intronic
1138322205 16:56125272-56125294 GCATAGAAGCATACAGAGCTGGG - Intergenic
1138560243 16:57797063-57797085 CCATAGAAGCAGAGAGACCTCGG + Intronic
1138623693 16:58232234-58232256 CCCCAGAAAGCGTCAGAGCTGGG - Intronic
1138637397 16:58352057-58352079 GCACAGAAACGGCCACAGCTGGG + Intronic
1138954924 16:61959636-61959658 ACACAGAAAGAGACAGAGGGAGG + Intronic
1139403981 16:66703884-66703906 ACACAGAAACAGACAGCCCTTGG + Intergenic
1141100467 16:81193973-81193995 CCACAGAAACTGAAAATGCTGGG + Intergenic
1141150786 16:81563328-81563350 AAACAGAAAGAGGCAGAGCTGGG - Intronic
1141644214 16:85358656-85358678 CCACACAAAGAGAAAGAGGTCGG - Intronic
1142146630 16:88495538-88495560 AGACAGACACAGGCAGAGCTGGG - Intronic
1202996082 16_KI270728v1_random:111753-111775 CGACATAAACATACAGAGCTGGG - Intergenic
1203022769 16_KI270728v1_random:424095-424117 CGACATAAACATACAGAGCTGGG - Intergenic
1142756510 17:2019464-2019486 CCAAAGACACGGCCAGAGCTTGG + Intronic
1142934632 17:3318104-3318126 CCACAGAGACAGCCAGGGCTAGG + Intergenic
1143758932 17:9087287-9087309 CCACAGAGAGACAGAGAGCTGGG + Intronic
1143860626 17:9888029-9888051 CCACAGAAACCTCCAGAGGTGGG - Intronic
1144726604 17:17505532-17505554 CCACACAGACAGACAGAGGCTGG + Intergenic
1147535826 17:41322877-41322899 CTTCAGAAACAGACAGATCTGGG - Intergenic
1147578550 17:41616268-41616290 GCAGAGAAACAGAGAGAGCAGGG + Intergenic
1148090618 17:45020696-45020718 CCACTAAGAGAGACAGAGCTGGG - Intergenic
1148337045 17:46848936-46848958 ACACACACACACACAGAGCTTGG + Intronic
1148387901 17:47248827-47248849 CCAAAGATAAAGAAAGAGCTGGG + Intergenic
1148488083 17:48004061-48004083 GCACAGAACAAGACAGAGCACGG - Intergenic
1148766704 17:50043821-50043843 CCAAGGAAACAGAGAAAGCTAGG - Intergenic
1148843106 17:50511745-50511767 CCAAAGAACCAGAAAGAGCTGGG + Intronic
1149016479 17:51914217-51914239 TCACAGTAAGAGACAGAGCCAGG + Intronic
1149470041 17:56909041-56909063 ACACAGGAACAGAACGAGCTGGG + Intronic
1149976553 17:61271582-61271604 ACACACACACACACAGAGCTGGG - Intronic
1149997513 17:61412649-61412671 CCACCGACACAGGCAGAGCCGGG + Exonic
1150932723 17:69602790-69602812 TCATAGTAAGAGACAGAGCTGGG + Intergenic
1151201110 17:72468654-72468676 CCACACAAACAGGGAGAGGTAGG - Intergenic
1151328206 17:73391645-73391667 CCACAGAAATTCACTGAGCTGGG - Intronic
1151330633 17:73404947-73404969 CCACAGTAAGTGACAGAGCTGGG - Intronic
1151512668 17:74570832-74570854 CCGGAGACGCAGACAGAGCTCGG + Intergenic
1154121582 18:11656655-11656677 CCCAATCAACAGACAGAGCTTGG + Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1155949505 18:31894914-31894936 ACACAGAAACAGACACAAGTAGG + Intronic
1156049112 18:32910385-32910407 CCTCTGAAACAAACAGAGCTGGG + Intergenic
1157131745 18:45013731-45013753 GCTCAGAAACAGTCAGGGCTGGG - Intronic
1157311883 18:46559198-46559220 CCACAGGAACAAACAGAGAATGG - Exonic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158933022 18:62339378-62339400 GCAGGGAAACAGACAGAGATAGG - Intronic
1159028029 18:63204394-63204416 CCACAAAAACAGAGAGGGGTTGG - Intronic
1159845203 18:73450817-73450839 CAGCAGCAACAGACAGAGTTTGG + Intergenic
1159857127 18:73602293-73602315 CTTCAGAGACAGCCAGAGCTAGG + Intergenic
1159960113 18:74548641-74548663 ACTCAGTAACAGACAGAGGTTGG + Intronic
1159997997 18:74985721-74985743 CCAAAGCAACAGGCAGAGTTGGG - Intronic
1160227797 18:77024805-77024827 ACACAGAAACAGGCACATCTGGG - Intronic
1160279332 18:77472785-77472807 GTACAGTAACAAACAGAGCTTGG - Intergenic
1160985252 19:1835684-1835706 TCCCAGAAACAGACTGACCTGGG - Intronic
1161005950 19:1936670-1936692 AAATAGAGACAGACAGAGCTAGG + Intergenic
1161141919 19:2653316-2653338 CAACAGACAAACACAGAGCTGGG + Intronic
1161349872 19:3785635-3785657 GCACAGAAACACACAGGGCTCGG + Intronic
1161672938 19:5624119-5624141 CCAGAGAGACTGACGGAGCTGGG - Intronic
1162069452 19:8145005-8145027 CCCCAGCAGCAGAGAGAGCTGGG + Intronic
1162344274 19:10110609-10110631 CCACAGGTCCAGGCAGAGCTGGG + Exonic
1162504187 19:11073113-11073135 ACACAGTAAAAGACAGAGGTAGG + Intergenic
1162924337 19:13922553-13922575 CCACAGGGAGAGGCAGAGCTGGG - Intronic
1163187463 19:15649133-15649155 CCAGAGAAGGGGACAGAGCTGGG - Intronic
1163217324 19:15890438-15890460 CCAGAGAAGGGGACAGAGCTGGG + Intronic
1165097730 19:33418770-33418792 CGACAAACACAGACAAAGCTAGG + Intronic
1165657795 19:37549241-37549263 GCACAGAAACACACACAGCCAGG - Intergenic
1165743948 19:38219291-38219313 CCTCAGAAAAAGACACAGTTAGG + Intronic
1165788617 19:38477548-38477570 ACACAGAAACAGACATAACCAGG + Intronic
1166032396 19:40142088-40142110 CCAAAGACACAGACAGAAATAGG + Intergenic
1166184336 19:41129799-41129821 ACACAGAAACAGGCAGAGCTGGG + Intergenic
1166700372 19:44878626-44878648 ACACAGACAGAGACAGAGCCAGG + Intronic
1167225928 19:48240231-48240253 CCACTGAAACACACAGAGGGAGG + Intronic
1167680045 19:50913525-50913547 CCACAGACAGAGACAGAGATGGG - Intergenic
1167858828 19:52266654-52266676 CCACAGAAACAGAGAGATACAGG - Intergenic
1168136145 19:54353232-54353254 GGACAGAGACAGACAGAGCAGGG + Exonic
1168254958 19:55160071-55160093 CCAGAGAGATACACAGAGCTGGG + Intronic
925841660 2:7997779-7997801 CCTCATAAACTGACAGAGCTGGG + Intergenic
925996178 2:9295256-9295278 ACACAGAAAGTGGCAGAGCTGGG - Intronic
926013953 2:9431967-9431989 TCACAGTAAGAGACAGAGCAAGG + Intronic
926113362 2:10196424-10196446 CCACAGAAACAGCCACAGTCTGG - Intronic
926329242 2:11811107-11811129 CCACAGAAGCAGAGGGTGCTTGG - Intronic
926410936 2:12601939-12601961 ACACAGAAACAGAAAGAGTGAGG - Intergenic
926887444 2:17611322-17611344 ACACAGCAAGAGTCAGAGCTGGG - Intronic
927080919 2:19629984-19630006 CAACAGAAACAGCCAGAACCAGG - Intergenic
927173686 2:20390856-20390878 CCACAGAAAACTTCAGAGCTGGG - Intergenic
927193394 2:20532123-20532145 TCACACAAGCAGGCAGAGCTTGG - Intergenic
927787832 2:25986022-25986044 AGACAGAAACAGACACAGTTAGG - Intergenic
928167387 2:28981119-28981141 CCACAGAAAGAGAGAGCACTGGG - Intronic
928581796 2:32715453-32715475 CCACAGAAACAAAAATAGCATGG - Intronic
928794107 2:34995775-34995797 CTTCAGAAAAAGAAAGAGCTGGG + Intergenic
929016344 2:37500560-37500582 CCACACAACAAGGCAGAGCTGGG - Intergenic
929751809 2:44723012-44723034 CCAAACAAAAACACAGAGCTGGG + Intronic
930231001 2:48843733-48843755 CCACAGAAACCAAATGAGCTTGG + Intergenic
930902368 2:56522970-56522992 CCATAAATACAAACAGAGCTGGG - Intergenic
932561937 2:72880846-72880868 CCAGAAAAACAGACAGATATAGG - Intergenic
932697025 2:73965499-73965521 CCACAGTAACTGACAGCGCTGGG + Intergenic
932782167 2:74566568-74566590 CAAGAGAAACAGACAAAGCTAGG + Intronic
933155749 2:78971452-78971474 CCATAGCAACAGACAGTTCTGGG + Intergenic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934174059 2:89563765-89563787 ACACAGAAGCAAACAGAGCCTGG + Intergenic
934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG + Intergenic
934284375 2:91638114-91638136 ACACAGAAGCAAACAGAGCCTGG + Intergenic
934315394 2:91913622-91913644 CAACATAAACATACAGAGCTGGG - Intergenic
934721775 2:96583194-96583216 CCACAGAATCAGACAGATAATGG - Intergenic
935100837 2:99994342-99994364 CCAAAGAAACAGAAAGAGAGAGG + Intronic
938432722 2:131260196-131260218 CCACAGTAACAGAAACAGCGTGG - Intronic
939114027 2:138040157-138040179 CCACAGAAACAGAAAGGACAAGG - Intergenic
940017143 2:149118804-149118826 CTTTAGAAACAGACAGACCTGGG - Intronic
940023885 2:149184704-149184726 CAAGAGAAAGAGACAGAGGTTGG - Intronic
940242966 2:151583091-151583113 ACACAGAAAGAGAGAGAGATGGG - Intronic
940243921 2:151593643-151593665 ACACAGAAAGAGAGAGAGATGGG - Intronic
940244881 2:151604196-151604218 ACACAGAAAGAGAGAGAGATGGG - Intronic
941118531 2:161501053-161501075 ACACAGAAAAAGAAAGTGCTTGG - Intronic
941788018 2:169520145-169520167 ACACACACACACACAGAGCTAGG - Intronic
942772580 2:179540081-179540103 CCAGCCAAACAGAGAGAGCTGGG + Intronic
943374551 2:187059503-187059525 ACACACACACACACAGAGCTAGG + Intergenic
944258351 2:197648446-197648468 CCACACCAACAAGCAGAGCTGGG - Intronic
945037157 2:205714300-205714322 TCCCAGAAGCAGACAGAGCTGGG - Intronic
946745681 2:222843211-222843233 CAACAGAAACATACAGAATTGGG + Intergenic
946797209 2:223368177-223368199 CTACAGAGTCAGACAGATCTGGG - Intergenic
946821710 2:223636496-223636518 CCACAGTAACTGACAAAACTTGG + Intergenic
947079820 2:226383549-226383571 CATTAGAATCAGACAGAGCTGGG + Intergenic
947603185 2:231467324-231467346 CCACAGCAGCAGACAGAGTTGGG - Intronic
948179351 2:235967205-235967227 GCAGAGAAACAGTCAGAGCCTGG - Intronic
948563446 2:238868626-238868648 CCACAGACACAGTCACAGCCAGG - Intronic
948948522 2:241234225-241234247 GCTCAGGAACTGACAGAGCTAGG + Intronic
1168999112 20:2154129-2154151 CCACAGAAAAAGCTAGAGCTTGG + Intronic
1169017428 20:2303352-2303374 CCACAGAGACAGAAAGAGTTGGG + Intronic
1169547198 20:6662455-6662477 CCAAAGATACAGTGAGAGCTAGG - Intergenic
1172189227 20:33051888-33051910 CCACAGACACAGTGACAGCTTGG + Intergenic
1172210880 20:33197703-33197725 CTTCAGAGACAGACAGACCTGGG - Intergenic
1173135125 20:40432649-40432671 CAACATAAAAAGGCAGAGCTGGG - Intergenic
1173171589 20:40729309-40729331 CCACAGAAACAGACAATATTAGG + Intergenic
1173863594 20:46300003-46300025 ACACTGAAATAGACTGAGCTAGG + Intronic
1174831558 20:53817805-53817827 CCAAAGACACACATAGAGCTGGG - Intergenic
1174880633 20:54275411-54275433 ACAGAGAAAAAGACAGAGCCTGG - Intergenic
1174890026 20:54381866-54381888 CCACAGAAAGGGAAAGAGGTGGG - Intergenic
1175246542 20:57585697-57585719 ACACAGGAAATGACAGAGCTGGG + Intergenic
1175433552 20:58926228-58926250 GTACAGGAACAGACAGAGCCTGG + Intergenic
1176324783 21:5383048-5383070 GCAAAGAAACAGACACATCTGGG - Intergenic
1178427007 21:32486818-32486840 CCACTGAAAGGGACAGGGCTAGG - Intronic
1178435886 21:32558218-32558240 AGACAGAAACAGACAGAGAGAGG + Intergenic
1178594118 21:33937349-33937371 TCACTGAACCAGACAAAGCTGGG + Intergenic
1178885518 21:36481935-36481957 CCACAGGCACACACAGAGCGAGG + Intronic
1179470210 21:41605372-41605394 TCCCAGAAAGAGACGGAGCTGGG + Intergenic
1179980634 21:44893964-44893986 AGACAGAGACAGACAGAGATGGG + Intronic
1180476799 22:15718126-15718148 CCACAGTAACAGAAACAGCGTGG - Intronic
1180542164 22:16459506-16459528 CAACATAAACATACAGAGCTGGG - Intergenic
1181095823 22:20504548-20504570 TCACAGACACAGACAGAGAGAGG - Intronic
1181443274 22:22949574-22949596 ACCAAGAAACAGACAGAGCCAGG - Intergenic
1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG + Intronic
1181713062 22:24703576-24703598 ACACAGAGAGAGACAGAGATAGG + Intergenic
1182043413 22:27255998-27256020 GCACAGACACAGAGACAGCTGGG + Intergenic
1183090325 22:35518087-35518109 CCTGGGAAACAGACAGAGTTGGG + Intergenic
1183173905 22:36208301-36208323 ACTCAGAAAGAGGCAGAGCTGGG + Intergenic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1184251055 22:43260614-43260636 TCACAGAAGCAGCCAAAGCTGGG + Intronic
1184277279 22:43416856-43416878 GCAAAGAAACACACAAAGCTCGG - Intronic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184506580 22:44907403-44907425 CCACACAAGCACACAGAGGTGGG - Intronic
1184538134 22:45101344-45101366 TGACAGAAAAAGAGAGAGCTGGG + Intergenic
1203295551 22_KI270736v1_random:40036-40058 CCACAGGAGGAGACAGGGCTAGG + Intergenic
949402304 3:3678703-3678725 CTACAAAAACAGACAAAACTGGG + Intergenic
949757037 3:7424054-7424076 ACACAGTAACAGAAACAGCTGGG - Intronic
949865344 3:8542550-8542572 CCAGAGAAACAGACACATCCAGG + Intronic
949890908 3:8733216-8733238 CCTCAGAAACCCACAAAGCTCGG + Intronic
949943531 3:9172773-9172795 TGACAGTAACAGAGAGAGCTGGG + Intronic
950171312 3:10840756-10840778 CCTCAGCAAGAAACAGAGCTTGG - Intronic
950447162 3:13045005-13045027 CCTCAGACACAGACAGGGCCAGG - Intronic
950689440 3:14643873-14643895 ACACAGATAGAGACAGTGCTAGG - Intergenic
950969921 3:17176082-17176104 CTGTAGAATCAGACAGAGCTGGG + Intronic
952006414 3:28847131-28847153 GCACAGAAATAGACAGGGCCTGG + Intergenic
954413700 3:50382517-50382539 CCACAGGAACAGACAGCGAAGGG - Intronic
954763624 3:52895741-52895763 CTATGGAAACAGCCAGAGCTAGG + Intronic
954892367 3:53942911-53942933 CCACGGAAGTAGACAGACCTGGG - Intergenic
957539572 3:81550580-81550602 TCACAGAATGAGACAGAGGTTGG + Intronic
959286208 3:104414500-104414522 CCATAGAAACTCATAGAGCTGGG + Intergenic
960814421 3:121658305-121658327 CCACGGAAACAGACACATCATGG + Exonic
961034379 3:123632226-123632248 TCACAGAGACAGAGAGAGCTGGG - Intronic
961992353 3:131205516-131205538 CCACAAAAAGAGACACAGCTGGG - Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
964311591 3:155399549-155399571 CCACAGACACAGAGAGGGGTGGG + Intronic
964445294 3:156751715-156751737 CCAGAGAAAGAGGCAGAGATTGG - Intergenic
964474937 3:157089647-157089669 GCATAGAATCAGACAGACCTGGG + Intergenic
965731170 3:171774114-171774136 ACACAGTTAGAGACAGAGCTGGG + Intronic
966260558 3:177973506-177973528 GCACAGAAAAAGGCAGAGCCTGG - Intergenic
966689275 3:182726449-182726471 ACACACACACAGACAGAGTTTGG + Intergenic
966977581 3:185099005-185099027 CCAGAGAAACAGAGATAGATGGG - Intronic
967099318 3:186203208-186203230 CGACTGAAAGAGACAGAGATGGG + Intronic
967106288 3:186257295-186257317 CCACAGATCCAGGTAGAGCTGGG + Intronic
967903177 3:194477830-194477852 CTACAGGTAGAGACAGAGCTGGG + Intronic
968273313 3:197421389-197421411 CCACAGATGCAGACAAAGCCCGG + Intergenic
969827908 4:9772581-9772603 ACACAGAAGCAAACAGAGCCTGG + Intronic
969923743 4:10565453-10565475 CCACAGTTAGAGACAGAGGTGGG + Intronic
970225684 4:13854356-13854378 ACACAGACACAGACAGACCTAGG - Intergenic
970875687 4:20867285-20867307 CCACAGTAACTAAAAGAGCTTGG + Intronic
971969090 4:33598723-33598745 CCAAAGAAACAGAAAGGGATGGG + Intergenic
972182185 4:36481339-36481361 AAAGAGAAACAGACAGAGATGGG - Intergenic
972287035 4:37659092-37659114 CCACTGAAATAGGCAGAGCTTGG + Intronic
972417629 4:38858175-38858197 ACAAAGAAACAGACAGTACTGGG + Intergenic
976094290 4:81490981-81491003 CAACGGAAACAGGAAGAGCTTGG + Intronic
976795913 4:88932225-88932247 CAACAGTAAATGACAGAGCTGGG - Intronic
977047872 4:92090167-92090189 ACACAGAAAGAGACAGAGAGAGG + Intergenic
977947632 4:102931703-102931725 CAACCTAAACATACAGAGCTGGG - Intronic
979825366 4:125226854-125226876 CCCCAAAAAGAGACATAGCTAGG + Intergenic
979951520 4:126898903-126898925 ACACAGAACCAGACAGGGATGGG + Intergenic
981261390 4:142723989-142724011 CCACAGCAACATACATATCTTGG + Intronic
983171114 4:164537628-164537650 CCACAGAAAAAGTTAGAGGTGGG + Intergenic
983384259 4:167037957-167037979 TCACAGAAACAGAAAGCTCTGGG + Intronic
983661682 4:170135571-170135593 CCACAGACACGAGCAGAGCTGGG - Intergenic
984707921 4:182861410-182861432 ACACAGAAAAAGACAGTGATTGG + Intergenic
985724659 5:1509618-1509640 CCACAGACACAAACCGAGCAAGG + Intronic
985984801 5:3505769-3505791 CCACAGAGACAGAAGGGGCTCGG - Intergenic
986011018 5:3715256-3715278 CCACGGAAAGGCACAGAGCTGGG + Intergenic
986264740 5:6182034-6182056 GCAGAGAGACAGACAGAGCGAGG + Intergenic
987115717 5:14725180-14725202 CAACAGACAGAGACACAGCTGGG - Intronic
987213484 5:15708747-15708769 CCAAAGAAAAAGACACAACTTGG - Intronic
987859916 5:23471388-23471410 CCATAGAAACAGACAGAGAGTGG - Intergenic
988821843 5:34894688-34894710 TCACAGCTAAAGACAGAGCTGGG - Intronic
989464743 5:41741649-41741671 CCCCAGAAACACACATCGCTGGG + Intronic
990087089 5:51992472-51992494 CCATAGAAACAGAAAGGGCCGGG + Intergenic
990215824 5:53530764-53530786 TCACAGATTCAGACAGAGTTGGG - Intergenic
990780039 5:59350342-59350364 TCACAGAAGCACACAGAGCCAGG + Intronic
992228746 5:74642694-74642716 CCACAGGAAGCGACAGAACTAGG + Intronic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994713240 5:103291684-103291706 CCACACAAACTGACAGAGGCAGG - Intergenic
994738909 5:103594061-103594083 CATCAGAAACTCACAGAGCTGGG - Intergenic
995537946 5:113156247-113156269 TCACAGAATCAGATAAAGCTGGG + Intronic
995556867 5:113338475-113338497 CCACAGAGTCATACAGAGATAGG + Intronic
996957318 5:129199703-129199725 CCAGAGAAGCAGACAGACTTAGG + Intergenic
997572850 5:134945902-134945924 CCATAGAATGAGACATAGCTAGG + Intronic
997580282 5:135012636-135012658 CCACACAAACAGTCAGCCCTGGG + Intergenic
998444761 5:142189984-142190006 CCACATCAAGAGGCAGAGCTTGG - Intergenic
998979987 5:147691359-147691381 TCACAGTAACAGAAGGAGCTGGG - Intronic
999207849 5:149862930-149862952 ACACAGTAAGAGACAGAGCCCGG - Intronic
999767428 5:154752175-154752197 CAGCAGAGCCAGACAGAGCTAGG - Intronic
1000603896 5:163307577-163307599 ACACACACACACACAGAGCTGGG - Intergenic
1001011662 5:168104439-168104461 TCACAGAAACTGGCAGAGCCAGG - Intronic
1001302869 5:170549811-170549833 CCACAGAAATAGAAGGAACTTGG + Intronic
1001907873 5:175487976-175487998 GCAGAGATCCAGACAGAGCTGGG - Intronic
1001909156 5:175500459-175500481 ACAGAGAAAAAAACAGAGCTTGG + Intronic
1001931899 5:175679080-175679102 CCACAGAAAGAGGTAGAACTTGG - Intronic
1001979972 5:176031322-176031344 CCAAGGAAACAGTCAGAGCAGGG + Intronic
1002237410 5:177812341-177812363 CCAAGGAAACAGTCAGAGCAGGG - Intergenic
1002914818 6:1520382-1520404 CCACATACACACACAGAGATGGG - Intergenic
1003153343 6:3571192-3571214 GCACAGCCACAGACAGATCTGGG - Intergenic
1003511074 6:6781088-6781110 CCACAGAATCAGGCCGAGCACGG - Intergenic
1006442253 6:34059923-34059945 CCACAAAAAGAGACTGAGGTAGG + Intronic
1006674147 6:35750112-35750134 ACACAGTAAGTGACAGAGCTGGG - Intergenic
1007800562 6:44388421-44388443 TGACAGAAAGAGACAGACCTTGG - Intronic
1008394831 6:50994307-50994329 CCACAGAAAAAGAAAAACCTAGG + Intergenic
1009274363 6:61655955-61655977 CTACAGAAACAAACACAGATGGG - Intergenic
1011457403 6:87566818-87566840 CCTCAGCAACCAACAGAGCTAGG + Intronic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1014119204 6:117703525-117703547 ACACAGAAACACACAGATCATGG - Intronic
1014885179 6:126771682-126771704 CCACAGATAGAAAGAGAGCTAGG - Intergenic
1015456780 6:133435451-133435473 CCCCAGACACAGTCAGAACTGGG - Intronic
1015738072 6:136422914-136422936 CAAAAGACACAGACAGACCTGGG + Intronic
1015767920 6:136738559-136738581 CCACAGCAACAGACAGTATTTGG + Intronic
1016063721 6:139656814-139656836 AGCTAGAAACAGACAGAGCTGGG - Intergenic
1016527364 6:145017283-145017305 GCACAGACACAGACAGGGCAAGG - Intergenic
1017605799 6:156131471-156131493 GCAGAGAAAGAGAAAGAGCTTGG - Intergenic
1017885872 6:158599064-158599086 CCACAGAAACAGACCGCGGGAGG - Intronic
1017978825 6:159380737-159380759 CCAGAGAAAGAGAGAGAGCCTGG - Intergenic
1019705058 7:2493654-2493676 GAACAGAAACAGAGAGAGCAGGG - Intergenic
1021045280 7:15915415-15915437 GCAAAGAAACAGCCAAAGCTAGG - Intergenic
1021941297 7:25681224-25681246 CCACAGATACCGCCTGAGCTGGG + Intergenic
1022218428 7:28288592-28288614 CTATAGAAACAGACAGATCAAGG + Intergenic
1022520333 7:31002450-31002472 GCACAGAAAGAAAGAGAGCTAGG - Intergenic
1022955914 7:35379889-35379911 CTCCAGAAACAGGGAGAGCTGGG + Intergenic
1024614290 7:51096046-51096068 ACAGAGAAAGAGACAGAGATAGG - Intronic
1025295141 7:57770709-57770731 ACACAGAAACCGACAGAGAGAGG - Intergenic
1025947231 7:66114073-66114095 CCACGAAAACAGACAGAGCCCGG + Intronic
1027286198 7:76648026-76648048 CCACAAAGACGGAAAGAGCTGGG + Intergenic
1027309455 7:76939342-76939364 AAACAGAAAAAGAAAGAGCTGGG + Intergenic
1028406890 7:90485095-90485117 CCACAGGACCACACAGGGCTTGG + Intronic
1029855986 7:103517256-103517278 CCCCAGAAACTGACAGATTTCGG - Intronic
1030065169 7:105653821-105653843 CCACAGAAAGGCACAGAGCCAGG - Intronic
1032062245 7:128734866-128734888 CCACAGAAAGAGAATGAGCTTGG + Intergenic
1032902314 7:136323744-136323766 CCACACACACACACAGATCTGGG - Intergenic
1033018387 7:137696052-137696074 CCACAGCACCAGCCAAAGCTAGG + Intronic
1034008941 7:147506890-147506912 CCACAGTAAGTGACAGAGTTGGG - Intronic
1035372435 7:158388023-158388045 CCAGAGAAACAGACTCAGCAGGG - Intronic
1035617073 8:1010520-1010542 CCACACACACATACAGAGTTCGG + Intergenic
1036183817 8:6607371-6607393 CCACAGAAACAGGCAAACTTGGG - Intronic
1036753039 8:11455267-11455289 CCCCAGACACACACAGAGCAAGG - Intronic
1036758788 8:11492337-11492359 CCACCCCAACAGACAGAGGTTGG - Intergenic
1037780498 8:21865192-21865214 CAACAGAAACAGACAGGGGTTGG + Intergenic
1037922338 8:22816177-22816199 ACACACAAAGGGACAGAGCTGGG - Intronic
1038069235 8:23995083-23995105 TGACAGGAACAGAGAGAGCTTGG + Intergenic
1038249187 8:25887046-25887068 ACACAGAGACAGACAGAGACAGG - Intronic
1038262479 8:26008473-26008495 CCACAGAGACACACAGTGGTTGG + Intronic
1038537196 8:28361789-28361811 CCACAGAAACTTGCCGAGCTTGG + Intronic
1039827985 8:41191079-41191101 TCAGAGAAACAGACCCAGCTGGG - Intergenic
1041477170 8:58279295-58279317 ACACAGGAACAGACAGAAGTTGG - Intergenic
1041589429 8:59559769-59559791 ACACAGAAAGAGGCAAAGCTTGG + Intergenic
1041794266 8:61729612-61729634 AAACAGAAACAGACAGACTTTGG - Intergenic
1041856672 8:62463977-62463999 CCACAGATACACACAAAACTGGG + Intronic
1044731925 8:95235759-95235781 CCTGAGAAACAGCCAGAGTTGGG + Intergenic
1045753548 8:105514538-105514560 TCACAAAAACCAACAGAGCTGGG - Intronic
1045755809 8:105540096-105540118 ACACAGAGAGAGACAGAGATGGG - Intronic
1047083587 8:121492032-121492054 CCTAATAAACAGACAGAGCCAGG + Intergenic
1047366421 8:124215740-124215762 CAACAGAATCAGACAGACCCTGG + Intergenic
1047392515 8:124464895-124464917 CCACAGAAGCCTACACAGCTTGG - Intergenic
1048125523 8:131630833-131630855 ACACAGTAACTGACAGAGCAGGG - Intergenic
1048335784 8:133501216-133501238 CCACAGACACAGAACGACCTAGG - Intronic
1048811259 8:138288638-138288660 CCAAAGAGACAGGCAGTGCTGGG + Intronic
1048827053 8:138438485-138438507 TCAAAGAAAAAAACAGAGCTAGG + Intronic
1051362258 9:16291657-16291679 TCACAGGATCAGTCAGAGCTGGG + Intergenic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1053273952 9:36769524-36769546 ACACAGAAAGAGACGGAGCATGG - Intergenic
1053444949 9:38145807-38145829 CCACAGAGCCAGTGAGAGCTGGG + Intergenic
1053553552 9:39109563-39109585 CCACAGACACAGGCATGGCTGGG + Intronic
1053817664 9:41929710-41929732 CCACAGACACAGGCATGGCTGGG + Intronic
1054107918 9:61073382-61073404 CCACAGACACAGGCATGGCTGGG + Intergenic
1054612939 9:67257743-67257765 CCACAGACACAGGCATGGCTGGG - Intergenic
1055113449 9:72582923-72582945 ACAAATAAACAGACAGGGCTGGG + Intronic
1055122159 9:72673802-72673824 CTAGGGAAACAGTCAGAGCTTGG - Intronic
1056536797 9:87535159-87535181 CCATTAAAATAGACAGAGCTTGG - Intronic
1057744917 9:97743429-97743451 CCACAGCAAATGACAGAGCTAGG + Intergenic
1057916280 9:99058021-99058043 CCTCAGGAACAGCCAGAGCCAGG + Intronic
1058136691 9:101315720-101315742 TCACAGACACACACAAAGCTGGG + Intronic
1058581684 9:106465548-106465570 CCTTAGAAATAGACAGACCTTGG + Intergenic
1059431556 9:114253570-114253592 CCTCAGAATCAGACAGACCTGGG + Intronic
1059993354 9:119885914-119885936 CCACAGGGAGATACAGAGCTGGG - Intergenic
1060006489 9:120004725-120004747 CCTCTGAAACACTCAGAGCTGGG - Intergenic
1060784455 9:126439207-126439229 CCACAGAAAGTGGCAGACCTGGG + Intronic
1061299123 9:129694753-129694775 ACACACACACACACAGAGCTTGG - Intronic
1062673016 9:137722880-137722902 CCACAGACACAGACACACCCCGG - Intronic
1062673025 9:137722917-137722939 CCACAGACACAGACACACCCCGG - Intronic
1062673042 9:137722991-137723013 CCACAGACACAGACACACCCCGG - Intronic
1062673051 9:137723028-137723050 CCACAGACACAGACACACCCCGG - Intronic
1062673171 9:137723474-137723496 CCACAGACACAGACACACCCCGG - Intronic
1185721862 X:2388674-2388696 ACACAGACACAGACAGAGGAAGG + Intronic
1186398360 X:9233524-9233546 CCCTAGAAAAAGACAGAGCAGGG - Intergenic
1186721515 X:12309250-12309272 CCACAAAGACAAACAGAACTTGG - Intronic
1188721770 X:33530826-33530848 GCATAGAAACAGACAGAGAAAGG - Intergenic
1188780682 X:34280147-34280169 CCACACCTACAAACAGAGCTGGG + Intergenic
1189242413 X:39535625-39535647 ACACAGAAAGAGAGAGAGATAGG - Intergenic
1189296715 X:39923626-39923648 CCACATAAACAGAAAGACCCTGG + Intergenic
1190333636 X:49250142-49250164 CCTCAGATCGAGACAGAGCTGGG + Exonic
1190787752 X:53668529-53668551 CCTGGGAAACAGACAGATCTGGG + Intronic
1190883217 X:54508313-54508335 GAACAGAGACAGACAGAGATTGG - Intergenic
1191749429 X:64525760-64525782 CTACAGAAACAAACAGAGCATGG + Intergenic
1191852808 X:65598314-65598336 AGACAGAAACAGACAGAGACAGG + Intronic
1194845306 X:98800098-98800120 ACACAGCTACCGACAGAGCTGGG + Intergenic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1197871082 X:131063450-131063472 CCACAGAAGCATACAGGGGTAGG + Intronic
1200425264 Y:3013509-3013531 CCACAGCCACACAAAGAGCTGGG - Intergenic
1200929607 Y:8685179-8685201 CCACAGAAACATAAAGAACAGGG + Intergenic
1200932299 Y:8708011-8708033 CCACAGAAAAATAGAGAACTTGG + Intergenic
1201038411 Y:9805634-9805656 CCACAGAAACATAAAGAACAGGG - Intergenic
1201183059 Y:11368441-11368463 CAACATAAACATACAGAGCTGGG - Intergenic
1202605153 Y:26633118-26633140 CCAGACAAACAGGAAGAGCTAGG - Intergenic