ID: 934112179

View in Genome Browser
Species Human (GRCh38)
Location 2:88754264-88754286
Sequence CAGTTGTGTGTACCTGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934112177_934112179 -1 Left 934112177 2:88754242-88754264 CCTTTGACTAACTGATATTGAGC No data
Right 934112179 2:88754264-88754286 CAGTTGTGTGTACCTGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934112179 Original CRISPR CAGTTGTGTGTACCTGGCAC TGG Intergenic
No off target data available for this crispr