ID: 934113734

View in Genome Browser
Species Human (GRCh38)
Location 2:88765291-88765313
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934113725_934113734 19 Left 934113725 2:88765249-88765271 CCAGCGGGGCAGCGGCAAGTCAG No data
Right 934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG No data
934113721_934113734 27 Left 934113721 2:88765241-88765263 CCCCGGGGCCAGCGGGGCAGCGG No data
Right 934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG No data
934113724_934113734 25 Left 934113724 2:88765243-88765265 CCGGGGCCAGCGGGGCAGCGGCA No data
Right 934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG No data
934113723_934113734 26 Left 934113723 2:88765242-88765264 CCCGGGGCCAGCGGGGCAGCGGC No data
Right 934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr