ID: 934116183

View in Genome Browser
Species Human (GRCh38)
Location 2:88796889-88796911
Sequence AATTCAAATGGATCAAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934116183_934116185 9 Left 934116183 2:88796889-88796911 CCATTATTTGATCCATTTGAATT No data
Right 934116185 2:88796921-88796943 TGAAAATCTCTTGTGTAAAATGG No data
934116183_934116187 11 Left 934116183 2:88796889-88796911 CCATTATTTGATCCATTTGAATT No data
Right 934116187 2:88796923-88796945 AAAATCTCTTGTGTAAAATGGGG No data
934116183_934116186 10 Left 934116183 2:88796889-88796911 CCATTATTTGATCCATTTGAATT No data
Right 934116186 2:88796922-88796944 GAAAATCTCTTGTGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934116183 Original CRISPR AATTCAAATGGATCAAATAA TGG (reversed) Intergenic
No off target data available for this crispr