ID: 934116184

View in Genome Browser
Species Human (GRCh38)
Location 2:88796901-88796923
Sequence TCATAAGTAAAAAATTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934116184_934116186 -2 Left 934116184 2:88796901-88796923 CCATTTGAATTTTTTACTTATGA No data
Right 934116186 2:88796922-88796944 GAAAATCTCTTGTGTAAAATGGG No data
934116184_934116187 -1 Left 934116184 2:88796901-88796923 CCATTTGAATTTTTTACTTATGA No data
Right 934116187 2:88796923-88796945 AAAATCTCTTGTGTAAAATGGGG No data
934116184_934116185 -3 Left 934116184 2:88796901-88796923 CCATTTGAATTTTTTACTTATGA No data
Right 934116185 2:88796921-88796943 TGAAAATCTCTTGTGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934116184 Original CRISPR TCATAAGTAAAAAATTCAAA TGG (reversed) Intergenic
No off target data available for this crispr