ID: 934116185

View in Genome Browser
Species Human (GRCh38)
Location 2:88796921-88796943
Sequence TGAAAATCTCTTGTGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934116184_934116185 -3 Left 934116184 2:88796901-88796923 CCATTTGAATTTTTTACTTATGA No data
Right 934116185 2:88796921-88796943 TGAAAATCTCTTGTGTAAAATGG No data
934116182_934116185 10 Left 934116182 2:88796888-88796910 CCCATTATTTGATCCATTTGAAT No data
Right 934116185 2:88796921-88796943 TGAAAATCTCTTGTGTAAAATGG No data
934116183_934116185 9 Left 934116183 2:88796889-88796911 CCATTATTTGATCCATTTGAATT No data
Right 934116185 2:88796921-88796943 TGAAAATCTCTTGTGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934116185 Original CRISPR TGAAAATCTCTTGTGTAAAA TGG Intergenic
No off target data available for this crispr