ID: 934116187

View in Genome Browser
Species Human (GRCh38)
Location 2:88796923-88796945
Sequence AAAATCTCTTGTGTAAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934116184_934116187 -1 Left 934116184 2:88796901-88796923 CCATTTGAATTTTTTACTTATGA No data
Right 934116187 2:88796923-88796945 AAAATCTCTTGTGTAAAATGGGG No data
934116183_934116187 11 Left 934116183 2:88796889-88796911 CCATTATTTGATCCATTTGAATT No data
Right 934116187 2:88796923-88796945 AAAATCTCTTGTGTAAAATGGGG No data
934116182_934116187 12 Left 934116182 2:88796888-88796910 CCCATTATTTGATCCATTTGAAT No data
Right 934116187 2:88796923-88796945 AAAATCTCTTGTGTAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934116187 Original CRISPR AAAATCTCTTGTGTAAAATG GGG Intergenic
No off target data available for this crispr