ID: 934119071

View in Genome Browser
Species Human (GRCh38)
Location 2:88822993-88823015
Sequence GTAGATTTCAAGCACAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934119068_934119071 24 Left 934119068 2:88822946-88822968 CCCTCAAAGTGGAGAAATATTTG No data
Right 934119071 2:88822993-88823015 GTAGATTTCAAGCACAACACTGG No data
934119070_934119071 -10 Left 934119070 2:88822980-88823002 CCATTTACAGCAAGTAGATTTCA No data
Right 934119071 2:88822993-88823015 GTAGATTTCAAGCACAACACTGG No data
934119069_934119071 23 Left 934119069 2:88822947-88822969 CCTCAAAGTGGAGAAATATTTGA No data
Right 934119071 2:88822993-88823015 GTAGATTTCAAGCACAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934119071 Original CRISPR GTAGATTTCAAGCACAACAC TGG Intergenic
No off target data available for this crispr