ID: 934122943

View in Genome Browser
Species Human (GRCh38)
Location 2:88857526-88857548
Sequence CTGGGAGTTACCCGATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934122936_934122943 5 Left 934122936 2:88857498-88857520 CCTTGCTGTCCTGCTCTGTGACA No data
Right 934122943 2:88857526-88857548 CTGGGAGTTACCCGATTGGAGGG No data
934122937_934122943 -4 Left 934122937 2:88857507-88857529 CCTGCTCTGTGACACTCTCCTGG No data
Right 934122943 2:88857526-88857548 CTGGGAGTTACCCGATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934122943 Original CRISPR CTGGGAGTTACCCGATTGGA GGG Intergenic
No off target data available for this crispr