ID: 934123553

View in Genome Browser
Species Human (GRCh38)
Location 2:88863889-88863911
Sequence TTGTAGGTGCAAAAACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934123547_934123553 17 Left 934123547 2:88863849-88863871 CCAAGACTCTATGAACTAGGAAC No data
Right 934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG No data
934123546_934123553 18 Left 934123546 2:88863848-88863870 CCCAAGACTCTATGAACTAGGAA No data
Right 934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934123553 Original CRISPR TTGTAGGTGCAAAAACTTGA GGG Intergenic
No off target data available for this crispr