ID: 934125205

View in Genome Browser
Species Human (GRCh38)
Location 2:88881777-88881799
Sequence CACCATCCCCAAAAATGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934125205_934125208 -10 Left 934125205 2:88881777-88881799 CCACTGCATTTTTGGGGATGGTG No data
Right 934125208 2:88881790-88881812 GGGGATGGTGGAAGTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934125205 Original CRISPR CACCATCCCCAAAAATGCAG TGG (reversed) Intergenic
No off target data available for this crispr