ID: 934126424

View in Genome Browser
Species Human (GRCh38)
Location 2:88897277-88897299
Sequence CAGGTCAGGGCCAAGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934126415_934126424 24 Left 934126415 2:88897230-88897252 CCATAAAATCTGTGCTGTCAAAC No data
Right 934126424 2:88897277-88897299 CAGGTCAGGGCCAAGGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934126424 Original CRISPR CAGGTCAGGGCCAAGGTTAT GGG Intergenic
No off target data available for this crispr