ID: 934133626

View in Genome Browser
Species Human (GRCh38)
Location 2:88972719-88972741
Sequence TCTGAGCTATAACACTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934133622_934133626 17 Left 934133622 2:88972679-88972701 CCACCTGATTCTCTGGACTAACA No data
Right 934133626 2:88972719-88972741 TCTGAGCTATAACACTGTGAGGG No data
934133623_934133626 14 Left 934133623 2:88972682-88972704 CCTGATTCTCTGGACTAACAGCT No data
Right 934133626 2:88972719-88972741 TCTGAGCTATAACACTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934133626 Original CRISPR TCTGAGCTATAACACTGTGA GGG Intergenic
No off target data available for this crispr