ID: 934136191

View in Genome Browser
Species Human (GRCh38)
Location 2:88998566-88998588
Sequence ACATAGAGACAGAACTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934136191_934136193 -2 Left 934136191 2:88998566-88998588 CCATTCCAGTTCTGTCTCTATGT No data
Right 934136193 2:88998587-88998609 GTCATTGACATATTTGAAGCAGG No data
934136191_934136194 13 Left 934136191 2:88998566-88998588 CCATTCCAGTTCTGTCTCTATGT No data
Right 934136194 2:88998602-88998624 GAAGCAGGTTCACTCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934136191 Original CRISPR ACATAGAGACAGAACTGGAA TGG (reversed) Intergenic
No off target data available for this crispr