ID: 934139854

View in Genome Browser
Species Human (GRCh38)
Location 2:89035941-89035963
Sequence CAGGTACAGCAGCCAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934139847_934139854 15 Left 934139847 2:89035903-89035925 CCCCTACTTGTATTTCTAGGATA No data
Right 934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG No data
934139845_934139854 30 Left 934139845 2:89035888-89035910 CCTGCTTTATGATCACCCCTACT No data
Right 934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG No data
934139848_934139854 14 Left 934139848 2:89035904-89035926 CCCTACTTGTATTTCTAGGATAT No data
Right 934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG No data
934139849_934139854 13 Left 934139849 2:89035905-89035927 CCTACTTGTATTTCTAGGATATC No data
Right 934139854 2:89035941-89035963 CAGGTACAGCAGCCAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934139854 Original CRISPR CAGGTACAGCAGCCAGTGTT GGG Intergenic
No off target data available for this crispr