ID: 934144247

View in Genome Browser
Species Human (GRCh38)
Location 2:89075834-89075856
Sequence CTGTACCCACAATTGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934144240_934144247 8 Left 934144240 2:89075803-89075825 CCCATTTGGAACAGCTGTATTAA No data
Right 934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG No data
934144237_934144247 29 Left 934144237 2:89075782-89075804 CCTTTGTTTTGGCCAATTTCTCC 0: 1353
1: 1777
2: 1511
3: 1080
4: 925
Right 934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG No data
934144239_934144247 17 Left 934144239 2:89075794-89075816 CCAATTTCTCCCATTTGGAACAG 0: 196
1: 420
2: 1579
3: 1997
4: 1674
Right 934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG No data
934144241_934144247 7 Left 934144241 2:89075804-89075826 CCATTTGGAACAGCTGTATTAAC No data
Right 934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG No data
934144236_934144247 30 Left 934144236 2:89075781-89075803 CCCTTTGTTTTGGCCAATTTCTC 0: 1403
1: 1777
2: 1443
3: 1064
4: 1003
Right 934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934144247 Original CRISPR CTGTACCCACAATTGGGCCT AGG Intergenic
No off target data available for this crispr