ID: 934146610

View in Genome Browser
Species Human (GRCh38)
Location 2:89100957-89100979
Sequence CTGCATGCATTGAGGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934146610_934146613 11 Left 934146610 2:89100957-89100979 CCGTGTTTCCTCAATGCATGCAG No data
Right 934146613 2:89100991-89101013 CCACCATTATCAAGAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934146610 Original CRISPR CTGCATGCATTGAGGAAACA CGG (reversed) Intergenic
No off target data available for this crispr