ID: 934151809

View in Genome Browser
Species Human (GRCh38)
Location 2:89154324-89154346
Sequence AGCCCACATCAGGTAGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934151798_934151809 14 Left 934151798 2:89154287-89154309 CCAGGGACCATTGGCAGCCTCCC No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151801_934151809 -3 Left 934151801 2:89154304-89154326 CCTCCCCTCTGCCTGGATTCAGC No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151797_934151809 19 Left 934151797 2:89154282-89154304 CCACTCCAGGGACCATTGGCAGC No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151804_934151809 -8 Left 934151804 2:89154309-89154331 CCTCTGCCTGGATTCAGCCCACA No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151799_934151809 7 Left 934151799 2:89154294-89154316 CCATTGGCAGCCTCCCCTCTGCC No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151802_934151809 -6 Left 934151802 2:89154307-89154329 CCCCTCTGCCTGGATTCAGCCCA No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data
934151803_934151809 -7 Left 934151803 2:89154308-89154330 CCCTCTGCCTGGATTCAGCCCAC No data
Right 934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934151809 Original CRISPR AGCCCACATCAGGTAGGGTT TGG Intergenic
No off target data available for this crispr