ID: 934151893

View in Genome Browser
Species Human (GRCh38)
Location 2:89154931-89154953
Sequence CAGAATAACGGGAATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934151893_934151899 13 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151899 2:89154967-89154989 AGCAGATCTGAGGACCACAGTGG No data
934151893_934151900 26 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data
934151893_934151897 3 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934151893 Original CRISPR CAGAATAACGGGAATGAGCC TGG (reversed) Intergenic
No off target data available for this crispr