ID: 934151897

View in Genome Browser
Species Human (GRCh38)
Location 2:89154957-89154979
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934151895_934151897 -8 Left 934151895 2:89154942-89154964 CCCGTTATTCTGGAAACTCTTCC No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data
934151896_934151897 -9 Left 934151896 2:89154943-89154965 CCGTTATTCTGGAAACTCTTCCA No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data
934151892_934151897 4 Left 934151892 2:89154930-89154952 CCCAGGCTCATTCCCGTTATTCT No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data
934151890_934151897 25 Left 934151890 2:89154909-89154931 CCTCTTTTCTGGATCTGTCAGCC No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data
934151893_934151897 3 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151897 2:89154957-89154979 ACTCTTCCAGAGCAGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr