ID: 934151899

View in Genome Browser
Species Human (GRCh38)
Location 2:89154967-89154989
Sequence AGCAGATCTGAGGACCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934151895_934151899 2 Left 934151895 2:89154942-89154964 CCCGTTATTCTGGAAACTCTTCC No data
Right 934151899 2:89154967-89154989 AGCAGATCTGAGGACCACAGTGG No data
934151893_934151899 13 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151899 2:89154967-89154989 AGCAGATCTGAGGACCACAGTGG No data
934151896_934151899 1 Left 934151896 2:89154943-89154965 CCGTTATTCTGGAAACTCTTCCA No data
Right 934151899 2:89154967-89154989 AGCAGATCTGAGGACCACAGTGG No data
934151892_934151899 14 Left 934151892 2:89154930-89154952 CCCAGGCTCATTCCCGTTATTCT No data
Right 934151899 2:89154967-89154989 AGCAGATCTGAGGACCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934151899 Original CRISPR AGCAGATCTGAGGACCACAG TGG Intergenic
No off target data available for this crispr