ID: 934151900

View in Genome Browser
Species Human (GRCh38)
Location 2:89154980-89155002
Sequence ACCACAGTGGTTGTACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934151896_934151900 14 Left 934151896 2:89154943-89154965 CCGTTATTCTGGAAACTCTTCCA No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data
934151893_934151900 26 Left 934151893 2:89154931-89154953 CCAGGCTCATTCCCGTTATTCTG No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data
934151895_934151900 15 Left 934151895 2:89154942-89154964 CCCGTTATTCTGGAAACTCTTCC No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data
934151898_934151900 -6 Left 934151898 2:89154963-89154985 CCAGAGCAGATCTGAGGACCACA No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data
934151892_934151900 27 Left 934151892 2:89154930-89154952 CCCAGGCTCATTCCCGTTATTCT No data
Right 934151900 2:89154980-89155002 ACCACAGTGGTTGTACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934151900 Original CRISPR ACCACAGTGGTTGTACCAGC TGG Intergenic
No off target data available for this crispr