ID: 934158022

View in Genome Browser
Species Human (GRCh38)
Location 2:89221340-89221362
Sequence CTGACAGTGCAGAGGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934158022_934158028 25 Left 934158022 2:89221340-89221362 CCCACCTGCCTCTGCACTGTCAG No data
Right 934158028 2:89221388-89221410 ATTTAGTCCACCATATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934158022 Original CRISPR CTGACAGTGCAGAGGCAGGT GGG (reversed) Intergenic
No off target data available for this crispr