ID: 934163345

View in Genome Browser
Species Human (GRCh38)
Location 2:89272702-89272724
Sequence GTTAAAGAGGTGATCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163345_934163354 24 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163345_934163349 -3 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163345_934163355 27 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163345 Original CRISPR GTTAAAGAGGTGATCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr