ID: 934163346

View in Genome Browser
Species Human (GRCh38)
Location 2:89272706-89272728
Sequence TAGGGTTAAAGAGGTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163346_934163355 23 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163346_934163349 -7 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163346_934163354 20 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163346 Original CRISPR TAGGGTTAAAGAGGTGATCA GGG (reversed) Intergenic
No off target data available for this crispr