ID: 934163347

View in Genome Browser
Species Human (GRCh38)
Location 2:89272707-89272729
Sequence CTAGGGTTAAAGAGGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163347_934163354 19 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163347_934163349 -8 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163347_934163355 22 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163347 Original CRISPR CTAGGGTTAAAGAGGTGATC AGG (reversed) Intergenic
No off target data available for this crispr