ID: 934163348

View in Genome Browser
Species Human (GRCh38)
Location 2:89272715-89272737
Sequence GGAGGTAACTAGGGTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163348_934163354 11 Left 934163348 2:89272715-89272737 CCTCTTTAACCCTAGTTACCTCC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163348_934163355 14 Left 934163348 2:89272715-89272737 CCTCTTTAACCCTAGTTACCTCC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163348 Original CRISPR GGAGGTAACTAGGGTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr