ID: 934163349

View in Genome Browser
Species Human (GRCh38)
Location 2:89272722-89272744
Sequence AACCCTAGTTACCTCCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163343_934163349 13 Left 934163343 2:89272686-89272708 CCCGTGGTGTCAGGATCCTGCCC No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163347_934163349 -8 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163346_934163349 -7 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163344_934163349 12 Left 934163344 2:89272687-89272709 CCGTGGTGTCAGGATCCTGCCCT No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data
934163345_934163349 -3 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163349 2:89272722-89272744 AACCCTAGTTACCTCCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163349 Original CRISPR AACCCTAGTTACCTCCTAGC AGG Intergenic
No off target data available for this crispr