ID: 934163351

View in Genome Browser
Species Human (GRCh38)
Location 2:89272725-89272747
Sequence GAGCCTGCTAGGAGGTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163351_934163354 1 Left 934163351 2:89272725-89272747 CCTAGTTACCTCCTAGCAGGCTC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163351_934163355 4 Left 934163351 2:89272725-89272747 CCTAGTTACCTCCTAGCAGGCTC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163351_934163358 22 Left 934163351 2:89272725-89272747 CCTAGTTACCTCCTAGCAGGCTC No data
Right 934163358 2:89272770-89272792 GGAGGTAAGAGATTCCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163351 Original CRISPR GAGCCTGCTAGGAGGTAACT AGG (reversed) Intergenic
No off target data available for this crispr