ID: 934163352

View in Genome Browser
Species Human (GRCh38)
Location 2:89272733-89272755
Sequence TGGAGAGAGAGCCTGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163352_934163358 14 Left 934163352 2:89272733-89272755 CCTCCTAGCAGGCTCTCTCTCCA No data
Right 934163358 2:89272770-89272792 GGAGGTAAGAGATTCCAAATAGG No data
934163352_934163355 -4 Left 934163352 2:89272733-89272755 CCTCCTAGCAGGCTCTCTCTCCA No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163352_934163354 -7 Left 934163352 2:89272733-89272755 CCTCCTAGCAGGCTCTCTCTCCA No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163352 Original CRISPR TGGAGAGAGAGCCTGCTAGG AGG (reversed) Intergenic
No off target data available for this crispr