ID: 934163353

View in Genome Browser
Species Human (GRCh38)
Location 2:89272736-89272758
Sequence AGATGGAGAGAGAGCCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163353_934163355 -7 Left 934163353 2:89272736-89272758 CCTAGCAGGCTCTCTCTCCATCT No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163353_934163358 11 Left 934163353 2:89272736-89272758 CCTAGCAGGCTCTCTCTCCATCT No data
Right 934163358 2:89272770-89272792 GGAGGTAAGAGATTCCAAATAGG No data
934163353_934163354 -10 Left 934163353 2:89272736-89272758 CCTAGCAGGCTCTCTCTCCATCT No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163353 Original CRISPR AGATGGAGAGAGAGCCTGCT AGG (reversed) Intergenic
No off target data available for this crispr