ID: 934163354

View in Genome Browser
Species Human (GRCh38)
Location 2:89272749-89272771
Sequence CTCTCCATCTGCAGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163353_934163354 -10 Left 934163353 2:89272736-89272758 CCTAGCAGGCTCTCTCTCCATCT No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163348_934163354 11 Left 934163348 2:89272715-89272737 CCTCTTTAACCCTAGTTACCTCC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163346_934163354 20 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163347_934163354 19 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163345_934163354 24 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163351_934163354 1 Left 934163351 2:89272725-89272747 CCTAGTTACCTCCTAGCAGGCTC No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163352_934163354 -7 Left 934163352 2:89272733-89272755 CCTCCTAGCAGGCTCTCTCTCCA No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data
934163350_934163354 2 Left 934163350 2:89272724-89272746 CCCTAGTTACCTCCTAGCAGGCT No data
Right 934163354 2:89272749-89272771 CTCTCCATCTGCAGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163354 Original CRISPR CTCTCCATCTGCAGCCATAT TGG Intergenic
No off target data available for this crispr