ID: 934163355

View in Genome Browser
Species Human (GRCh38)
Location 2:89272752-89272774
Sequence TCCATCTGCAGCCATATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934163347_934163355 22 Left 934163347 2:89272707-89272729 CCTGATCACCTCTTTAACCCTAG No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163348_934163355 14 Left 934163348 2:89272715-89272737 CCTCTTTAACCCTAGTTACCTCC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163351_934163355 4 Left 934163351 2:89272725-89272747 CCTAGTTACCTCCTAGCAGGCTC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163345_934163355 27 Left 934163345 2:89272702-89272724 CCTGCCCTGATCACCTCTTTAAC No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163350_934163355 5 Left 934163350 2:89272724-89272746 CCCTAGTTACCTCCTAGCAGGCT No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163352_934163355 -4 Left 934163352 2:89272733-89272755 CCTCCTAGCAGGCTCTCTCTCCA No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163353_934163355 -7 Left 934163353 2:89272736-89272758 CCTAGCAGGCTCTCTCTCCATCT No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data
934163346_934163355 23 Left 934163346 2:89272706-89272728 CCCTGATCACCTCTTTAACCCTA No data
Right 934163355 2:89272752-89272774 TCCATCTGCAGCCATATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934163355 Original CRISPR TCCATCTGCAGCCATATTGG AGG Intergenic
No off target data available for this crispr