ID: 934165213

View in Genome Browser
Species Human (GRCh38)
Location 2:89288183-89288205
Sequence CTTTCTGAAGGGCAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934165198_934165213 27 Left 934165198 2:89288133-89288155 CCCTACCAGCATGTTCCTAGTGT No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data
934165204_934165213 -9 Left 934165204 2:89288169-89288191 CCCCCGAAGCCTGGCTTTCTGAA No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data
934165202_934165213 12 Left 934165202 2:89288148-89288170 CCTAGTGTCTCAGGTGCAGCTCC No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data
934165205_934165213 -10 Left 934165205 2:89288170-89288192 CCCCGAAGCCTGGCTTTCTGAAG No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data
934165200_934165213 22 Left 934165200 2:89288138-89288160 CCAGCATGTTCCTAGTGTCTCAG No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data
934165199_934165213 26 Left 934165199 2:89288134-89288156 CCTACCAGCATGTTCCTAGTGTC No data
Right 934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934165213 Original CRISPR CTTTCTGAAGGGCAGGTGAA GGG Intergenic
No off target data available for this crispr