ID: 934169131

View in Genome Browser
Species Human (GRCh38)
Location 2:89324922-89324944
Sequence TGCTCTAACCTGGACATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934169131_934169135 -8 Left 934169131 2:89324922-89324944 CCACCTATGTCCAGGTTAGAGCA No data
Right 934169135 2:89324937-89324959 TTAGAGCAGCACACATAGGAAGG No data
934169131_934169136 3 Left 934169131 2:89324922-89324944 CCACCTATGTCCAGGTTAGAGCA No data
Right 934169136 2:89324948-89324970 CACATAGGAAGGCCTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934169131 Original CRISPR TGCTCTAACCTGGACATAGG TGG (reversed) Intergenic
No off target data available for this crispr