ID: 934169478

View in Genome Browser
Species Human (GRCh38)
Location 2:89327840-89327862
Sequence TGTTAGGTTTAAAAGTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934169478_934169479 -8 Left 934169478 2:89327840-89327862 CCACGCAACTTTTAAACCTAACA No data
Right 934169479 2:89327855-89327877 ACCTAACAGAAATGACACATTGG No data
934169478_934169481 15 Left 934169478 2:89327840-89327862 CCACGCAACTTTTAAACCTAACA No data
Right 934169481 2:89327878-89327900 AATTTTAATTGCACTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934169478 Original CRISPR TGTTAGGTTTAAAAGTTGCG TGG (reversed) Intergenic
No off target data available for this crispr