ID: 934172940

View in Genome Browser
Species Human (GRCh38)
Location 2:89555297-89555319
Sequence ATGTTGTCATTGTTCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934172934_934172940 24 Left 934172934 2:89555250-89555272 CCCTGGAGCCACCTTCCTCTGGA No data
Right 934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG No data
934172935_934172940 23 Left 934172935 2:89555251-89555273 CCTGGAGCCACCTTCCTCTGGAG No data
Right 934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG No data
934172937_934172940 13 Left 934172937 2:89555261-89555283 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG No data
934172936_934172940 16 Left 934172936 2:89555258-89555280 CCACCTTCCTCTGGAGTTCTTGT No data
Right 934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG No data
934172939_934172940 9 Left 934172939 2:89555265-89555287 CCTCTGGAGTTCTTGTGATGGCA No data
Right 934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934172940 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG Intergenic
No off target data available for this crispr