ID: 934175418

View in Genome Browser
Species Human (GRCh38)
Location 2:89574701-89574723
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934175418_934175420 -4 Left 934175418 2:89574701-89574723 CCTAGGACCAACTGTGCAGACAG No data
Right 934175420 2:89574720-89574742 ACAGACAGACCCTCCTTCACAGG 0: 6
1: 0
2: 2
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934175418 Original CRISPR CTGTCTGCACAGTTGGTCCT AGG (reversed) Intergenic
No off target data available for this crispr