ID: 934182989

View in Genome Browser
Species Human (GRCh38)
Location 2:89644505-89644527
Sequence GGTCACCCCATTCCAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934182987_934182989 19 Left 934182987 2:89644463-89644485 CCTATGCACACAAATTTGAATTT No data
Right 934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934182989 Original CRISPR GGTCACCCCATTCCAAAGCA TGG Intergenic
No off target data available for this crispr