ID: 934184580

View in Genome Browser
Species Human (GRCh38)
Location 2:89660188-89660210
Sequence CCTTCTTTGCAGGAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934184571_934184580 13 Left 934184571 2:89660152-89660174 CCTTGAAGATGCTGGTGTACCCT No data
Right 934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG No data
934184573_934184580 -7 Left 934184573 2:89660172-89660194 CCTGACCTGCCTCCAGCCTTCTT No data
Right 934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG No data
934184572_934184580 -6 Left 934184572 2:89660171-89660193 CCCTGACCTGCCTCCAGCCTTCT No data
Right 934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934184580 Original CRISPR CCTTCTTTGCAGGAGATGGA TGG Intergenic
No off target data available for this crispr