ID: 934186625

View in Genome Browser
Species Human (GRCh38)
Location 2:89683605-89683627
Sequence CAACATAAACATACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934186623_934186625 9 Left 934186623 2:89683573-89683595 CCTAATAAAAAACTGGTTGCTGT No data
Right 934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG No data
934186622_934186625 13 Left 934186622 2:89683569-89683591 CCATCCTAATAAAAAACTGGTTG No data
Right 934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG No data
934186620_934186625 22 Left 934186620 2:89683560-89683582 CCTTTTTGGCCATCCTAATAAAA No data
Right 934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934186625 Original CRISPR CAACATAAACATACAGAGCT GGG Intergenic
No off target data available for this crispr