ID: 934188745

View in Genome Browser
Species Human (GRCh38)
Location 2:89766807-89766829
Sequence TCCGGACCAAGCGGGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934188745_934188755 19 Left 934188745 2:89766807-89766829 CCTAAGCTCCCGCTTGGTCCGGA No data
Right 934188755 2:89766849-89766871 TTCTCACACCACCAAGCCTGCGG No data
934188745_934188756 20 Left 934188745 2:89766807-89766829 CCTAAGCTCCCGCTTGGTCCGGA No data
Right 934188756 2:89766850-89766872 TCTCACACCACCAAGCCTGCGGG No data
934188745_934188751 -4 Left 934188745 2:89766807-89766829 CCTAAGCTCCCGCTTGGTCCGGA No data
Right 934188751 2:89766826-89766848 CGGAGGGCCCTCTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934188745 Original CRISPR TCCGGACCAAGCGGGAGCTT AGG (reversed) Intergenic