ID: 934197813

View in Genome Browser
Species Human (GRCh38)
Location 2:89854707-89854729
Sequence AATTTTAATTGCACTTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934197813_934197816 15 Left 934197813 2:89854707-89854729 CCATAGGAAGTGCAATTAAAATT No data
Right 934197816 2:89854745-89854767 TGTTAGGTTTAAAAGTTGCGTGG No data
934197813_934197814 -1 Left 934197813 2:89854707-89854729 CCATAGGAAGTGCAATTAAAATT No data
Right 934197814 2:89854729-89854751 TCCAATGTGTCATTTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934197813 Original CRISPR AATTTTAATTGCACTTCCTA TGG (reversed) Intergenic
No off target data available for this crispr